NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt8g105250_001

Export assay as CSV

Narrative Ubiquitin fusion degradation protein 1 homolog (AHRD V1 ***- Q9ES53); contains Interpro domain(s) IPR004854 Ubiquitin fusion degradation protein UFD1 chr08_pseudomolecule_IMGAG_V3.5 31205836-31210767 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 10
Chromosome unknown
cM position 7.43749
Assay ID
Assay Name Vf_Mt8g105250_001
Reference Allele Sequences
Sequence ID Allele Phenotype
C:C resistant
T:T susceptible
Polymorphism sequence AGCATCTCTGCATATTGATTATCCAATGTTGTTTGAACTTCGTAATGATGC[Y]G
CTGAGCGAGTTTCTCATTGTGGTGTTCTGGAGTTCATTGCAGAGGAAGGCATGAT
ATACATGCCMTACTGG
Reference allele sequence alignment
Validation plot
Genotype data