NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt7g100730_001

Export assay as CSV

Narrative Interactor of constitutive active ROPs 2, chloroplastic (AHRD V1 ***- Q9ZQC5) chr07_pseudomolecule_IMGAG_V3.5 31784123-31779911 F EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 5
Chromosome unknown
cM position 55.2973
Assay ID
Assay Name Vf_Mt7g100730_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
C:C susceptible
Polymorphism sequence GAAAAGCTGAAGAGGAGATTGAAGAAGCAAAGAAGCAGATAGTATCCTTGTCAAA
GAAGCTGGAGGAATCCCATCAACAGTTTTCGGAACTTTCCGCTTC[Y]GATGAAG
CACGACTTCAAGAACTGAGTAAAATATCTCAGGATCGAGATCGAGCATGGCAGTC
TGAACTTGAGGCTGTCCAGAAGCAGCACTCAATGGATT
Reference allele sequence alignment
Validation plot
Genotype data