NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt7g102310_001

Export assay as CSV

Narrative Dual specificity phosphatase Cdc25 (AHRD V1 **** Q8GY31); contains Interpro domain(s) IPR001763 Rhodanese-like chr07_pseudomolecule_IMGAG_V3.5 32719463-32722233 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 5
Chromosome unknown
cM position 50.5071
Assay ID
Assay Name Vf_Mt7g102310_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
C:C susceptible
Polymorphism sequence TCGTCGATGTCAGRGACGACGAGAGGACTCACGACGGTCACATATCCGGTTCTCT
TCATTACGCTAGCGACGGTTTCGACCAAAACATCTCCAAGCT[Y]CTTCATGATG
TTAAGGGAAAAGATACCCTCGTCTTTCACTGCGCTCTAAGTCAGGT
Reference allele sequence alignment
Validation plot
Genotype data