NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt1g083460_001

Export assay as CSV

Narrative Ribosomal protein L18 (AHRD V1 ***- B7FMF5_MEDTR); contains Interpro domain(s) IPR000039 Ribosomal protein L18e chr01_pseudomolecule_IMGAG_V3.5 21658874-21661038 F EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 4
Chromosome unknown
cM position 26.9868
Assay ID
Assay Name Vf_Mt1g083460_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
C:C susceptible
Polymorphism sequence AGGAAGGTAGAATTGCTGTAGTTGTGGGTGCTGTAACTGATGATATCCG[Y]GTG
TACGAAGTTCCAGCCATCAAAGTTGTAGCACTTAGGTTTACAGAGACTGCAAGGG
CAAGGATTGAAAAGGCTGGAGGAGAATGCTTGACATTCGATCTC
Reference allele sequence alignment
Validation plot
Genotype data