NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt4g077610_001

Export assay as CSV

Narrative Serine/threonine-protein phosphatase 4 regulatory subunit 2 (AHRD V1 *-** Q9W2U4) chr04_pseudomolecule_IMGAG_V3.5 25269103-25272829 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 3
Chromosome unknown
cM position 85.343
Assay ID
Assay Name Vf_Mt4g077610_001
Reference Allele Sequences
Sequence ID Allele Phenotype
A:A resistant
C:C susceptible
Polymorphism sequence TATCCACAAGAACCAGTACAAGAGACTGATGCCATAGAGATGCCAAGTGAAAAGC
AGCAGGAGCAGCAATCTGATGGTGCACAAAATGGCACCGAG[M]CTTCGGTAACA
GACAATGACGAAGTAATGGTTGAGGCTGATACGGGTGACGATGTGACCATTGAAA
TGGAAACTTTTGAAGA
Reference allele sequence alignment
Validation plot
Genotype data