NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt8g088590_001

Export assay as CSV

Narrative Dual specificity tyrosine-phosphorylation-regulated kinase 1A (AHRD V1 *-** Q2TAE3); contains Interpro domain(s) IPR016253 Integrin-linked protein kinase chr08_pseudomolecule_IMGAG_V3.5 24967035-24960813 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 3
Chromosome unknown
cM position 21.4532
Assay ID
Assay Name Vf_Mt8g088590_001
Reference Allele Sequences
Sequence ID Allele Phenotype
G:G resistant
A:A susceptible
Polymorphism sequence CCTCCGGCTCCTTACGGAAGACGTTAAGCCGGCAATTCACGCGTCAGGCTTCGCT
CGATCCGCGCCGGAATAATCTCCGATTTAGCTTCGGTCGCCAATC[R]TCGCTTG
ATCCGATCCGGCGGAGTACTAGCGAGGATCAGTCGGAACTCACCGTGCCGGAGAA
TCTTGACTCCACCATGCAGCTTCTGTTCATGG
Reference allele sequence alignment
Validation plot
Genotype data