NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt4g031820_001

Export assay as CSV

Narrative Cytochrome P450 monooxygenase CYP72A61 (AHRD V1 ***- Q2MJ08_MEDTR); contains Interpro domain(s) IPR002401 Cytochrome P450, E-class, group I chr04_pseudomolecule_IMGAG_V3.5 9618323-9614618 F EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 2
Chromosome unknown
cM position 200.156
Assay ID
Assay Name Vf_Mt4g031820_001
Reference Allele Sequences
Sequence ID Allele Phenotype
C:C resistant
A:A susceptible
Polymorphism sequence GGAGTGCACTGGATTGGATTTGGTTCACACCAAAAAGAATAGAGAAACGTTTGAA
ACAACAAGGTCTTAAAGGAAATTCATAT[M]GAATCATGGTTGGAGATATTAGAG
ATATGGTGAAAATGATCAAAGAAGCTAAATCTAAACYCATGGACCCTTACTCTAA
TGATATTGCTCCTCGTGTTTT
Reference allele sequence alignment
Validation plot
Genotype data