NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt4g035200_001

Export assay as CSV

Narrative Receptor-like protein kinase 5 (AHRD V1 ***- P47735); contains Interpro domain(s) IPR002290 Serine/threonine protein kinase chr04_pseudomolecule_IMGAG_V3.5 11011452-11006643 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 2
Chromosome unknown
cM position 198.482
Assay ID
Assay Name Vf_Mt4g035200_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
G:G susceptible
Polymorphism sequence AAAATGGAAACAAGCATCTTTTCACAAAGTGGATATTGATGCTGATGAAATA[K]
GTAATTTGAATGAAGATAATTTGATCGGCCACGGTGGTACGGGAAAGGTTTATCG
AGTCGCGTTGAAGAAAANCGGAATGGTAGTGGCCGTGAAGCA
Reference allele sequence alignment
Validation plot
Genotype data