NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt3g108320_001

Export assay as CSV

Narrative Potassium channel (AHRD V1 ***- Q9SCF5_DAUCA); contains Interpro domain(s) IPR000595 Cyclic nucleotide-binding chr03_pseudomolecule_IMGAG_V3.5 38652492-38645317 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 2
Chromosome unknown
cM position 166.116
Assay ID
Assay Name Vf_Mt3g108320_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
C:C susceptible
Polymorphism sequence GAGGGAGCAAAATTCTTATGACCGATGGCTCAGAAGTAGAAGATCTAAGCGCCTT
AAGAGAGAATGA[Y]GAGTTATACATCCTCTAATCATAGCATCAAATAGCGTCAA
TGATAATCATCTTATCTAAACAGATAAGATTGCAATGTA
Reference allele sequence alignment
Validation plot
Genotype data