NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt3g008540_001

Export assay as CSV

Narrative Molybdopterin synthase sulfur carrier subunit (AHRD V1 ***- Q9S7A3); contains Interpro domain(s) IPR010034 Molybdopterin converting factor, subunit 1 chr03_pseudomolecule_IMGAG_V3.5 1584404-1586532 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 2
Chromosome unknown
cM position 0
Assay ID
Assay Name Vf_Mt3g008540_001
Reference Allele Sequences
Sequence ID Allele Phenotype
T:T resistant
G:G susceptible
Polymorphism sequence CTGTTTTTTGCACGTGCGCGTGATCTTACTGGCTTGAATGAGGTACCATTGGAAG
TGTCATCTGGGAGTACTACTCAAGATTGTTTGAAAAAGCTTCT[K]GTTCAATTT
CCGCGCTTGGARGAAATACAAGGATGCATGGTTCTGGCTCTGAATGAGGAGTATA
CATTRGATTCAACCATTGTTAAAGACAAGGATGAG
Reference allele sequence alignment
Validation plot
Genotype data