NIAB - National Institute of Agricultural Botany

Assay information: Vf_Mt5g097360_001

Export assay as CSV

Narrative Potyvirus VPg interacting protein (AHRD V1 ***- B0ZZ79_ARAHY); contains Interpro domain(s) IPR004082 Protein of unknown function DUF1423, plant chr05_pseudomolecule_IMGAG_V3.5 41607135-41610779 E EGN_Mt100125 20100825
References Webb, A., Cottage, A., Wood, T., Khamassi, K., Hobbs, D., Gostkiewicz, K., White, M., Khazaei, H., Ali, M., Street, D., Duc, G., Stoddard, F., Maalouf, F., Ogbonnaya, F. C., Link, W., Thomas, J. and O'Sullivan, D. M. (2015) A SNP-based consensus genetic map for synteny-based trait targeting in faba bean (Vicia faba L.). Plant Biotechnology Journal. ISSN 1467-7652 (In Press)
Map NV13 x Memphis
Linkage Group 1
Chromosome unknown
cM position 196.084
Assay ID
Assay Name Vf_Mt5g097360_001
Reference Allele Sequences
Sequence ID Allele Phenotype
G:G resistant
A:A susceptible
Polymorphism sequence CCTCCACGACAGCAGTCTCGGGTTGGAGGATTGCAAACATCTCTATCTCTGGTTC
CTTTGGATCCGCGCTTGTCTCCTGAGGATCCTAGGTC[R]AATTCTGATAATCTT
CGAGAATCTCCTACKGAAAGTGCTAGTTCTAGAGAAACCTGGCCTACTGCTGATG
CAATTGCTGCAAAGAAGATGGAGAA
Reference allele sequence alignment
Validation plot
Genotype data